Blueprint studio · Spec sheets · Amber callouts · Free shipping over $75

theplayground.com.sg Blueprint · Rev.39

Sheet A · Product board

pure encapsulations liposomal glutathione 60 caps Liquid Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

Unit price

USD24.87

USD50.87

Pay in 4 interest-free payments of $6.22 Learn more

Field rating

4.8

Verified studio score · Spec revision current

Fit · Size

pure encapsulations liposomal glutathione 60 caps

pure encapsulations liposomal glutathione 60 caps Liquid Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

SKU: 32804260649

Dispatch

Shipping Estimate
USA

USA

CAN

Ships within 48 hours · Estimated delivery Sep 21 - Sep 26

Description

pure encapsulations liposomal glutathione 60 caps Liquid Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

Spectracell Functional Intracellular Nutrition Test – Revolution Health & Wellness

ldh-1: AATCAACAATTTTCATGTCT and TAAAAATCGCGCGCATTTGA

antioxidant skincare

Size:16 Kapseln

New insights on the role of lipid metabolism in the metabolic reprogramming of macrophages

Exchange/Return Notes

We offer a 30-day return/exchange service after receiving.
Final sale items are not eligible for returns or exchanges.
To process your return/exchange, please contact us at [email protected]
Please click here for more details>>> Return & Exchange Policy

You may also like

GHK-Cu Before and After: Real Copper Peptide Results

GHK-Cu Before and After: Real Copper Peptide Results

US$ 29.08

4.9 (28 reviews)

ghk-cu wound-healing properties ghk cu promotes collagen synthesis The Effect of the Human Peptide on Gene Expression Relevant GHK-Cu Copper Peptide Oral Liquid – GHK-Cu Peptides Before and After: –

ghk-cu wound-healing properties ghk cu promotes collagen synthesis The Effect of the Human Peptide on Gene Expression Relevant GHK-Cu Copper Peptide Oral Liquid – GHK-Cu Peptides Before and After: –

US$ 29.31

4.7 (8 reviews)

Epigenetic mechanisms activated by GHK-Cu increase skin collagen density in clinical trial

Epigenetic mechanisms activated by GHK-Cu increase skin collagen density in clinical trial

US$ 24.67

4.1 (15 reviews)

QUBIT QUBIT GHK-Cu Copper Peptide Face Cream – 4% Peptides Moisturizer for Fine Lines, Wrinkles, Firming, Deep Hydration & Collagen – 2400mg GHK-Cu – for All Skin Types, 30g

QUBIT QUBIT GHK-Cu Copper Peptide Face Cream – 4% Peptides Moisturizer for Fine Lines, Wrinkles, Firming, Deep Hydration & Collagen – 2400mg GHK-Cu – for All Skin Types, 30g

US$ 21.14

4.0 (20 reviews)

GHK-Cu Peptide Injection in Dubai

GHK-Cu Peptide Injection in Dubai

US$ 25.79

4.0 (27 reviews)

Unlock the power of GHK-CU ✨ This advanced peptide is known for supporting collagen production, improving skin texture, and promoting a smoother, more radiant complexion. From fine lines and uneven tone to

Unlock the power of GHK-CU ✨ This advanced peptide is known for supporting collagen production, improving skin texture, and promoting a smoother, more radiant complexion. From fine lines and uneven tone to

US$ 22.09

4.9 (24 reviews)

GHK-Cu: Tissue Repair Signaling Molecule in Skincare | Felicia Zhang posted on the topic

GHK-Cu: Tissue Repair Signaling Molecule in Skincare | Felicia Zhang posted on the topic

US$ 23.99

4.2 (22 reviews)

Buy GHK-Cu Iceland from PharmaGrade.Store

Buy GHK-Cu Iceland from PharmaGrade.Store

US$ 21.18

4.1 (26 reviews)

Figure 2 from GHK – Copper Peptide in Skin Remodeling and Anti-Aging ! GHK-Cu in Skin Remodeling

Figure 2 from GHK – Copper Peptide in Skin Remodeling and Anti-Aging ! GHK-Cu in Skin Remodeling

US$ 24.07

4.8 (26 reviews)

GHK-Cu: Mechanism of Action, Collagen Stimulation, and Clinical Evidence

GHK-Cu: Mechanism of Action, Collagen Stimulation, and Clinical Evidence

US$ 29.58

4.1 (11 reviews)

HapiPatch Glow Up GHK-Cu Copper Peptide Patches

HapiPatch Glow Up GHK-Cu Copper Peptide Patches

US$ 21.86

4.7 (5 reviews)

WeCare

WeCare

US$ 27.28

4.7 (20 reviews)

GHK-Cu in the NAD+ Push Patch: A Smarter Way to Stimulate Collagen, He – Hi, Finch

GHK-Cu in the NAD+ Push Patch: A Smarter Way to Stimulate Collagen, He – Hi, Finch

US$ 27.83

5.0 (28 reviews)

GHK-Cu Cooper Peptide: The Complete Skin & Repair Guide (2026)

GHK-Cu Cooper Peptide: The Complete Skin & Repair Guide (2026)

US$ 26.91

5.0 (28 reviews)

ghk cu injection transformation Ever heard of GHK-Cu peptide? It's a naturally occurring copper peptide

ghk cu injection transformation Ever heard of GHK-Cu peptide? It's a naturally occurring copper peptide

US$ 24.61

4.0 (24 reviews)

GHK-Cu Topical Night Serum – VEAUTY

GHK-Cu Topical Night Serum – VEAUTY

US$ 23.62

4.8 (30 reviews)

Copper Peptides Serum for Face - Peptides Collagen Renewal & Anti-Aging Serum - GHK-Cu, EGF, Hyaluronic Acid,Collagen

Copper Peptides Serum for Face - Peptides Collagen Renewal & Anti-Aging Serum - GHK-Cu, EGF, Hyaluronic Acid,Collagen

US$ 27.91

4.2 (27 reviews)

ghk-cu stimulates collagen synthesis production ⚡ THE POWER COMBO: + BPC-157 = NEXT-LEVEL RESULTS Here's Bio Mystery GHK-Cu Copper Peptide –

ghk-cu stimulates collagen synthesis production ⚡ THE POWER COMBO: + BPC-157 = NEXT-LEVEL RESULTS Here's Bio Mystery GHK-Cu Copper Peptide –

US$ 21.93

4.3 (6 reviews)

GHK-Cu: The Peptide That Transforms Skin and Tissue Health – Calibrate IV

GHK-Cu: The Peptide That Transforms Skin and Tissue Health – Calibrate IV

US$ 21.63

4.7 (8 reviews)

Part ✌️ of Getting Ready for the Holidays: The combination of Sculptra, a PLLA collagen biostimulator and GHK-Cu (copper) peptide is a powerful approach to building collagen and elastin for firmer, plumper

Part ✌️ of Getting Ready for the Holidays: The combination of Sculptra, a PLLA collagen biostimulator and GHK-Cu (copper) peptide is a powerful approach to building collagen and elastin for firmer, plumper

US$ 21.33

4.8 (11 reviews)