Blueprint studio · Spec sheets · Amber callouts · Free shipping over $75

theplayground.com.sg Blueprint · Rev.39

Sheet A · Product board

pure encapsulations liposomal glutathione 60 caps 30/60ct | Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

Unit price

USD26.32

USD74.32

Pay in 4 interest-free payments of $6.58 Learn more

Field rating

4.4

Verified studio score · Spec revision current

Fit · Size

pure encapsulations liposomal glutathione 60 caps

pure encapsulations liposomal glutathione 60 caps 30/60ct | Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

SKU: 26028857437

Dispatch

Shipping Estimate
USA

USA

CAN

Ships within 48 hours · Estimated delivery Sep 19 - Sep 24

Description

pure encapsulations liposomal glutathione 60 caps 30/60ct | Spectracell Functional Intracellular Nutrition antioxidant skincare Size:16 Kapseln

Spectracell Functional Intracellular Nutrition Test – Revolution Health & Wellness

ldh-1: AATCAACAATTTTCATGTCT and TAAAAATCGCGCGCATTTGA

antioxidant skincare

Size:16 Kapseln

New insights on the role of lipid metabolism in the metabolic reprogramming of macrophages

Exchange/Return Notes

We offer a 30-day return/exchange service after receiving.
Final sale items are not eligible for returns or exchanges.
To process your return/exchange, please contact us at [email protected]
Please click here for more details>>> Return & Exchange Policy

You may also like

5 Best Glutathione Supplements in 2026

5 Best Glutathione Supplements in 2026

US$ 20.75

4.6 (24 reviews)

Reduced Glutathione Supplement, 1000mg Pure Glutathione with Alpha Lipoic Acid & Milk Thistle for Skin, Liver & Immune Support, Nature's Craft, 120ct : Target

Reduced Glutathione Supplement, 1000mg Pure Glutathione with Alpha Lipoic Acid & Milk Thistle for Skin, Liver & Immune Support, Nature's Craft, 120ct : Target

US$ 25.70

4.8 (27 reviews)

Glutathione | Glutathione Capsules | Glutathione Veg Capsules

Glutathione | Glutathione Capsules | Glutathione Veg Capsules

US$ 20.85

4.4 (14 reviews)

Glutathione

Glutathione

US$ 21.34

4.6 (23 reviews)

Doctor's BEST Glutathione + Milk Thistle Supplement - Supports Liver Health & Antioxidant Activity for Women & Men, Comprehensive Formula, Non-GMO, Gluten Free, Soy Free, Vegan

Doctor's BEST Glutathione + Milk Thistle Supplement - Supports Liver Health & Antioxidant Activity for Women & Men, Comprehensive Formula, Non-GMO, Gluten Free, Soy Free, Vegan

US$ 21.85

4.5 (20 reviews)

NSF Certified Glutathione Supplement 500mg - 200 Reduced L Glutathione Caps | L-Glutathione Supplement For Antioxidant & Immune Support - 500mg Per Serving

NSF Certified Glutathione Supplement 500mg - 200 Reduced L Glutathione Caps | L-Glutathione Supplement For Antioxidant & Immune Support - 500mg Per Serving

US$ 22.85

4.2 (8 reviews)

Best Glutathione Supplement

Best Glutathione Supplement

US$ 22.72

4.5 (25 reviews)

Glutathione Supplements Reviews & Top Picks

Glutathione Supplements Reviews & Top Picks

US$ 28.86

4.8 (5 reviews)

Glutathione Supplement - Strongest DNA Verified Glutathione Reduced

Glutathione Supplement - Strongest DNA Verified Glutathione Reduced

US$ 26.81

4.0 (19 reviews)

NOW Foods Supplements, Glutathione 500 mg, With Milk Thistle Extract & Alpha Lipoic Acid, Free Radical Neutralizer*, 60 Veg Capsules : Health & Household

NOW Foods Supplements, Glutathione 500 mg, With Milk Thistle Extract & Alpha Lipoic Acid, Free Radical Neutralizer*, 60 Veg Capsules : Health & Household

US$ 29.41

4.3 (5 reviews)

Glutathione Whitening Pills - 120 Capsules 2000mg Glutathione - Effective Skin Lightening Supplement - Dark Spots, Melasma & Acne Scar Remover, Hyperpigmentation Treatment

Glutathione Whitening Pills - 120 Capsules 2000mg Glutathione - Effective Skin Lightening Supplement - Dark Spots, Melasma & Acne Scar Remover, Hyperpigmentation Treatment

US$ 22.83

4.2 (12 reviews)

GHK-Cu Cream

GHK-Cu Cream

US$ 21.47

4.4 (15 reviews)

Copper Peptides (GHK-Cu) for Skin: Complete Guide 2026

Copper Peptides (GHK-Cu) for Skin: Complete Guide 2026

US$ 24.66

4.1 (5 reviews)

GHK-Cu: The Regenerative Peptide for Skin, Hair, and Beyond

GHK-Cu: The Regenerative Peptide for Skin, Hair, and Beyond

US$ 22.30

4.4 (6 reviews)

GHK-Cu is a copper peptide used in regenerative medicine to support collagen production, tissue repair, and cellular renewal throughout the body. It's for individuals looking to improve skin firmness, brightness, and visible

GHK-Cu is a copper peptide used in regenerative medicine to support collagen production, tissue repair, and cellular renewal throughout the body. It's for individuals looking to improve skin firmness, brightness, and visible

US$ 28.28

4.8 (19 reviews)

Can GHK-Cu Copper Peptide Tighten Skin After Weight Loss?

Can GHK-Cu Copper Peptide Tighten Skin After Weight Loss?

US$ 26.20

4.7 (12 reviews)

GHK-Cu: The Regenerative Peptide for Skin, Hair, and Healing

GHK-Cu: The Regenerative Peptide for Skin, Hair, and Healing

US$ 21.85

4.7 (19 reviews)

GHK-Cu is everywhere right now, but what does the science actually say? Read now: https://bit.ly/4r9Q8mJ This copper-binding peptide has drawn attention for its potential role in skin repair, regeneration, and inflammation support

GHK-Cu is everywhere right now, but what does the science actually say? Read now: https://bit.ly/4r9Q8mJ This copper-binding peptide has drawn attention for its potential role in skin repair, regeneration, and inflammation support

US$ 28.26

4.6 (14 reviews)

GHK-Cu Peptide

GHK-Cu Peptide

US$ 20.39

4.7 (10 reviews)

GHK-Cu Peptide Therapy: The Definitive Clinical Guide to Gene Modulation, Protocols, and Efficacy

GHK-Cu Peptide Therapy: The Definitive Clinical Guide to Gene Modulation, Protocols, and Efficacy

US$ 29.74

4.0 (13 reviews)